Identification of Сf-9 gene alleles of resistance to leaf mold in F1 tomato hybrids bred by Poisk Agrofirm

UDC 635.64:631:527:632.9
https://doi.org/10.25630/PAV.2021.55.18.004

Eroshevskaya A.S., Egorova A.A., Milyukova N.A., Pyrsikov A.S.

The article presents the results of molecular genetic analysis of F1 tomato hybrids of different commodity groups for presence of Cf-9 gene alleles of resistance to leaf mold. The molecular genetic analysis was carried out in the laboratory of marker and genomic plant breeding of FSBSI VNIISB in 2019. 16 F1 tomato hybrids were used as the object of the study, including 10 large-fruited, 1 brush, 1 cocktail and 4 cherry. The repetition of studies is two-fold (one frequency – one plant). To identify alleles of the Cf-9 gene for cladosporiosis resistance, a SCAR marker with the following primers was used: CS5 (TTTCCAACTTACAATCCCTTC), DS1 (GAGAGCTCAACCTTTACGAA), CS1 (GCCGTTCAAGTTGGGTGTT). The reaction mixture for PCR with a volume of 25 µl contained 50–100 ng of DNA, 2.5 mM dNTP, 3 mM MgSO4, 10 pM of each primer, 2 units. Taq-polymerase (LLC NPF Synthol) and 2x standard PCR buffer. The reaction was carried out in the Termal Cycler Bio-Rad T 100 amplifier according to the program 95 °C – 5 min, 35 cycles 95 °C – 20 s, 60 °C – 30 s, 72 °C – 30 s, the final elongation for 5 minutes at 72 °C. The PCR results were visualized by electrophoresis in a 1.7% agarose gel with 1x TAE buffer, the results were analyzed using the Gel Doc 2000 system (Bio-Rad Laboratories, Inc., USA). The identification of the Cf-9 resistance gene to cladosporiosis in the studied tomato F1 hybrids revealed fragments of 378 bp (Cf-9 allele) and 507 bp (9DC allele), which indicates their resistance to this disease. According to the research results, 13 out of 16 tomato F1 hybrids are resistant to cladosporiosis, and 12 of them have only Cf-9 alleles, 1 hybrid has both Cf-9 and 9DC resistance alleles in the genotype. Dominant homozygotes for the Cf-9 gene will be used in breeding programs of Poisk Agrofirm to create donor lines for resistance to cladosporiosis.

Key words: tomato, leaf mold, molecular genetic analysis, resistance, donor

Eroshevskaya A.S., post-graduate student, junior research fellow, ARRIVG – branch of FSBSI FSVC

Egorova A.A., Cand. Sci. (Agr.), senior research fellow, ARRIVG – branch of FSBSI FSVC. E-mail: edvaaed@rambler.ru

Milyukova N.A., Cand. Sci. (Biol.), senior research fellow of Laboratory of Marker and Genomic Plant Breeding, FSBSI All-Russian Research Institute of Agricultural Biotechnology (ARRIAB), Associate Professor of the Department of Genetics, Selection and Seed Production, Russian State Agrarian University – Moscow Timiryazev Agricultural Academy (RSAU – MTAA). E-mail: milyukovan@gmail.com

Pyrsikov A.S., Cand. Sci. (Agr.), research fellow of the laboratory of genomic and marker-assisted plant breeding, ARRIAB. E-mail: andrey.pyrsikov@yandex.ru

  1. Akhatov A.K. The world of tomato through the eyes of a phytopathologist. Moscow. KMK Scientific Press Ltd. 2016. 292 p. (In Russ.).
  2. Manual of the tomato diseases. Practical guide for seed growers, vegetable growers and agricultural consultants. Ed. B. Gabor. Seminis. 1997. 81 p. (In Russ.).
  3. Ignatova S.I., Tereshonkova T.A., Bagirova S.F. Molecular studies in the field of tomato breeding for disease resistance: a brief overview of recent achievements and priority areas. Gavrish. 2008. No3. Pp. 44–47 (In Russ.).
  4. Khlestkina E.K. Molecular markers in genetic studies and breeding. Vavilov journal of genetics and breeding. 2013. Vol. 17. No4-2. Pp. 1044–1054 (In Russ.).
  5. Chesnokov Yu.V., Kosolapov V.M. Genetic resources of plants and acceleration of the breeding process. Moscow. Ugresh Printing House LLC. 2016. 172 p. (In Russ.).
  6. Barone A. Molecular marker-assisted selection for resistance to pathogens in tomato. A paper presented during the FAO international workshop on «Marker assisted selection: a fast track to increase genetic gain in plant and animal breeding?». 2003. Pp. 29–34.
  7. Moose St.P., Mumm R.H. Molecular plant breeding as the foundation for 21st century crop improvement. Plant Physiol. 2008. Vol. 147. Pp. 969–977. DOI: 10.1104/pp.108.118232.
  8. Ignatova S.I. The role of the hereditary potential of tomato resistance in the system of complex protection in protected ground. Gavrish. 2001. No6. Pp. 18–20. (In Russ.).
  9. Plaschke J., Ganal M.W., Röder M.S. Detection of genetic diversity in closely related bread wheat using microsatellite markers. Theor. Appl. Genet. 1995. Vol. 91. Pp. 1001–1007. DOI: 10.1007/BF00223912.
  10. Shamshin I.N., Kudryavtsev A.M., Saveliev N.I. Creation of genetic passports of apple varieties based on the analysis of polymorphism of microsatellite loci of the genome: methodology. Michurinsk. 2013. 44 p. (in Russ.).

PDF(Rus)

For citing: Identification of Сf-9 gene alleles of resistance to leaf mold in F1 tomato hybrids bred by Poisk Agrofirm. A.S. Eroshevskaya, A.A. Egorova, N.A. Milyukova, A.S. Pyrsikov. Potato and vegatables. 2021. No3. Pp. 35-37. https://doi.org/10.25630/PAV.2021.55.18.004 (In Russ.).

This entry was posted in Breeding and seed growing and tagged , , , , . Bookmark the permalink.