Molecular genetic analysis of F1 tomato hybrids for resistance to Fusarium wilt

UDC 635.64:631.52:632
https://doi.org/10.25630/PAV.2021.44.34.006

Eroshevskaya A.S., Egorova A.A., Milyukova N.A., Pyrsikov A.S.

One of the most dangerous diseases of tomato is fusarium wilt, caused by phytopathogenic fungus Fusarium oxysporum f. sp. lycopersici. The growing of tomato resistant varieties and hybrids is the most effective method to control this disease. Now plant analysis for alleles of resistance genes is successfully carried out using molecular markers that allow to identify differences in studied samples at DNA level. The aim of the research is a molecular genetic analysis of tomato F1 hybrids selected by the Poisk AgroFirm for resistance to fusarium wilt (gene I2). As an object of research, 17 hybrids of tomato F1 of different product groups (large-fruited, brush, cocktail, cherry) were taken. The analysis was carried out in the laboratory of marker and genomic plant breeding of FSBSI VNIISB in 2019. The functional marker I-2 with primers I-2/5F (CAAGGAACTGCGTCTGTCTG) and I-2/5R (ATGAGCAATTTGTGGCCAGT) was used to identify I2 gene alleles. The PCR was carried out in the Termal Cycler Bio-Rad T 100 amplifier, the results were visualized by electrophoresis in a 1.7% agarose gel with 1x TAE buffer and were analyzed using the Gel Doc 2000 system. The fragments 633 bp (I-2 allele) and 566 bp (I-2C allele) in investigated tomato hybrids indicate their resistance to this disease. Among 17 hybrids 16 are resistant to fusarium wilt, 4 hybrids from them are dominant homozygotes for I2 gene (I-2 alleles). Hybrid F1 835/19 has both I-2 and I-2C alleles. To test the I2 gene effectiveness it is planned to assess tomato F1 hybrids by artificial inoculation in seedling phase (Fusarium oxysporum f. sp. lycopersici races 1 and 2). Dominant homozygotes for I2 gene will be used in breeding programs for creating donor lines of resistance to fusarium wilt if the results of marker analysis are confirmed.

Key words: tomato, hybrid, fusarium wilt, molecular genetic analysis, resistance, donor

Eroshevskaya A.S., post-graduate student, junior research fellow, ARRIVG – branch of FSBSI FSVC. E-mail: eroshnast@yandex

Egorova A.A., Cand. Sci. (Agr.), senior research fellow, ARRIVG – branch of FSBSI FSVC. E-mail: edvaaed@rambler.ru

Milyukova N.A., Cand. Sci. (Biol.), senior research fellow of laboratory of marker-assisted and genomic plant breeding, FSBSI All-Russian Research Institute of Agricultural Biotechnology (ARRIAB), associate professor of the Department of Genetics, Selection and Seed Production, Russian State Agrarian University – Moscow Timiryazev Agricultural Academy (RSAU – MTAA). E-mail: milyukovan@gmail.com

Pyrsikov A.S., Cand. Sci. (Agr.), research fellow of laboratory of marker-assisted and genomic plant breeding, FSBSI ARRIAB. E-mail: andrey.pyrsikov@yandex.ru

  1. Tomato disease resistances in the post-genomics era / Yuling Bai, Zhe Yan, E. Moriones, R. Fernandez-Munoz. Acta Hortic. 2018. Vol. 1207. Pp. 1–18. DOI: 10.17660/ActaHortic.2018.1207.1.
  2. Manual of the tomato diseases. Practical guide for seed growers, vegetable growers and agricultural consultants. Ed. B. Gabor. Seminis. 1997. 81 p. (In Russ.).
  3. Akhatov A.K. The world of tomato through the eyes of a phytopathologist. Moscow. KMK Scientific Press Ltd. 2016. 292 p. (In Russ.).
  4. Variability and geographical distribution of Fusarium oxysporum f.sp. licopersici physiological races and field performance of resistant sources in Brazil. A.M. Gonçalves, H. Costa, M.E.N. Fonseca, L.S. Boiteux, C.A. Lopes, A. Reis. Acta Hortic. 2018. 1207. Pp. 45–50. DOI: 10.17660/ActaHortic.2018.1207.5.
  5. Khlestkina E.K. Molecular markers in genetic studies and breeding. Vavilov journal of genetics and breeding. 2013. Vol. 17. No4-2. Pp. 1044–1054 (In Russ.).
  6. De Vicente M.C., Fulton T. Using molecular marker technology in studies on plant genetic diversity. IPGRI and Cornell University. 2003 [Web resource] URL: https://www.bioversityinternational.org/fileadmin/user_upload/online_library/publications/pdfs/Molecular_Markers_Volume_1_en.pdf. Date of access: 16.02.21.
  7. Mapping of the loci controlling the resistance to Pyrenophora teres f. teres and Cochliobolus sativus in two double haploid barley populations. O.S. Afanasenko, A.V. Koziakov, P. Hedlay, N.M. Lashina, A.V. Anisimova, O. Manninen, M. Jalli, E.K. Potokina. Vavilov journal of genetics and breeding. 2014. Vol.18. No4-1. Pp. 751–764. (In Russ.).
  8. Genome-wide dissection of Fusarium resistance in tomato reveals multiple complex loci. M.B. Sela-Buurlage, O. Budai-Hadrian, Q. Pan, L. Carmel-Goren, R. Vunsch, D. Zamir, R. Fluhr. Mol. Genet. Genomics. 2001. Vol. 265 (6). Pp. 1104–1111. DOI: 10.1007/s004380100509.
  9. An RFLP marker in tomato linked to the Fusarium oxysporum resistance gene I2. M. Sarfatti, J. Katan, R. Fluhr, D. Zamir. Theor. Appl. Genet. 1989. Vol. 78 (5). Pp. 755–759. DOI: 10.1007/BF00262574.
  10. Simons G. et al. Dissection of the fusarium I2 gene cluster in tomato reveals six homologs and one active gene copy. Plant Cell. 1998. Vol. 10(6). Pp. 1055–1068. DOI: 10.1105/tpc.10.6.1055.
  11. Bournival B.L., Scott J.W., Vallejos C.E. An isozyme marker for resistance to race 3 of Fusarium oxysporum f. sp. lycopersici in tomato. Theor. Appl. Genet. 1989. Vol. 78 (4). Pp. 489–494. DOI: 10.1007/BF00290832.
  12. Tanksley S.D., Costello W. The size of the L. pennellii chromosome 7 segment containing the I-3 gene in tomato breeding lines measured by RFLP probing. Rept. Tomato Genet. Coop. 1991. Vol. 41. P. 60.
  13. Fine mapping of the tomato I-3 gene for fusarium wilt resistance and elimination of a co-segregating resistance gene analogue as a candidate for I-3. M.N. Hemming, S. Basuki, D.J. McGrath, B.J. Carroll, D.A. Jones. Theor. Appl. Genet. 2004. Vol. 109 (2). Pp. 409–418. DOI: 10.1007/s00122-004-1646-4.
  14. Catanzariti A.M., Lim G.T., Jones D.A. The tomato I-3 gene: a novel gene for resistance to Fusarium wilt disease. New Phytol. 2015. Vol. 207 (1). Pp. 106–118 DOI: 10.1111/nph.13348.
  15. Correlation of genetic and physical structure in the region surrounding the I2 Fusarium oxysporum resistance locus in tomato. G. Segal, M. Sarfatti, M.A. Schaffer, N. Ori, D. Zamir, R. Fluhr. Mol Gen Genet. 1992. Vol. 231 (2). Pp. 179–185. DOI: 10.1007/BF00279789.
  16. Plaschke J., Ganal M.W., Röder M.S. Detection of genetic diversity in closely related bread wheat using microsatellite markers. Theor. Appl. Genet. 1995. Vol. 91. Pp. 1001–1007. DOI: 10.1007/BF00223912.
  17. Shamshin I.N., Kudryavtsev A.M., Saveliev N.I. Creation of genetic passports of apple varieties based on the analysis of the polymorphism of microsatellite genome loci: guidelines. Michurinsk. 2013. 44 p. (In Russ.).

PDF(Rus)

For citing: Molecular genetic analysis of F1 tomato hybrids for resistance to Fusarium wilt. A.S. Eroshevskaya, A.A. Egorova, N.A. Milyukova, A.S. Pyrsikov. Potato and vegetables. 2021. No5. Pp. 37-40. https://doi.org/10.25630/PAV.2021.44.34.006 (In Russ.).

This entry was posted in Breeding and seed growing and tagged , , , , , . Bookmark the permalink.